Millipore Sigma Vibrant Logo

17-10032 ChIPAb+ Trimethyl-Histone H3 (Lys36) - ChIP Validated Antibody and Primer Set, rabbit monoclonal

View Products on Sigmaaldrich.com
17-10032
25 assays  25 assays per set. Recommended use: ~2 μL of antibody per chromatin immunoprecipitation (dependent upon biological context).
Retrieving price...
Price could not be retrieved
Minimum Quantity is a multiple of
Maximum Quantity is
Upon Order Completion More Information
You Saved ()
 
Request Pricing
Limited Availability
Limited Availability
In Stock 
Discontinued
Limited Quantities Available
Availability to be confirmed
    Remaining : Will advise
      Remaining : Will advise
      Will advise
      Contact Customer Service
      Contact Customer Service

      Special Offers

       

      Contact Customer Service

      Overview

      Replacement Information

      Key Spec Table

      Species ReactivityKey Applications
      H, ChChIP, WB, Cell Function Assay, DB
      Description
      Catalogue Number17-10032
      Brand Family Upstate
      Trade Name
      • ChIPAb+
      • Upstate
      DescriptionChIPAb+ Trimethyl-Histone H3 (Lys36) - ChIP Validated Antibody and Primer Set, rabbit monoclonal
      OverviewAll ChIPAb+ antibodies are individually validated for chromatin precipitation, every lot, every time. Each ChIPAb+ antibody set includes control primers (tested every lot by qPCR) to biologically validate your IP results in a locus-specific context. The qPCR protocol and primer sequences are provided, allowing researchers to validate ChIP protocols when using our antibody in their chromatin context. Each set also includes a negative control antibody to ensure specificity of the ChIP reaction.
      The ChIPAb+ Trimethyl-Histone H3 (Lys36) set includes the Trimethyl-Histone H3 (Lys36) antibody, a negative control antibody (normal rabbit IgG), and qPCR primers which amplify a 147 bp region of human BDNF intron. The Trimethyl-Histone H3 (Lys36) and negative control antibodies are supplied in a scalable "per ChIP" reaction size and can be used to functionally validate the precipitation of Trimethyl-Histone H3 (Lys36)-associated chromatin.
      Alternate Names
      • H3K36me3
      • Histone H3 (tri methyl K36)
      • H3 histone family, member T
      • histone 3, H3
      • histone cluster 3, H3
      Background InformationHistones are highly conserved proteins that serve as the structural scaffold for the organization of nuclear DNA into chromatin. The four core histones, H2A, H2B, H3, and H4, assemble into an octamer (2 molecules of each). Subsequently, 146 base pairs of DNA are wrapped around the octamer, forming a nucleosome, the basic subunit of chromatin. Histones are modified post-translationally by the actions of enzymes in both the nucleus and cytoplasm. These modifications regulate DNA transcription, repair, recombination, and replication. The most commonly studied modifications are acetylation, phosphorylation, methylation, and ubiquitination. These modifications can alter local chromatin architecture, or recruit trans-acting factors that recognize specific histone modifications (the "histone code" hypothesis). The modifications occur predominantly on the N-terminal and C-terminal tails that extend beyond the nucleosome core particle. Methylation of histone H3 on Lys36 (H3K36me2/3) is tightly associated with actively transcribed genes, and this modification is found primarily within the coding region, suggesting H3K36 methylation is necessary for efficient RNA polymerase II elongation and processivity.
      References
      Product Information
      FormatPurified
      Control
      • Includes negative control rabbit IgG antibody and primers specific for human BDNF Intron.
      PresentationAnti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50 μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Store at -20°C.

      Normal Rabbit IgG. One vial containing 125 µg Rabbit IgG in 125 µL of storage buffer containing 0.05% sodium azide. Store at -20°C.

      ChIP Primers, BDNF Intron. One vial containing 75 μL of 5 μM of each primer specific for human BDNF intron. Store at -20°C.
      FOR: ACCCCAACCTCTAACAGCATTA
      REV: TGTCTCTCAGCAGTCTTGCATT
      Quality LevelMQ100
      Applications
      ApplicationThis ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers.
      Key Applications
      • Chromatin Immunoprecipitation (ChIP)
      • Western Blotting
      • Cell Function Assay
      • Dot Blot
      Application NotesChromatin Immunoprecipitation:
      Sonicated chromatin prepared from HeLa cells (1 X 106 cell equivalents per IP) were subjected to chromatin immunoprecipitation using 2 µg of either Normal rabbit IgG or 2 µL Anti-trimethyl-Histone H3 (Lys36) and the Magna ChIP™ A Kit (Cat. # 17-610). Successful immunoprecipitation of trimethyl-Histone H3 (Lys36) associated DNA fragments was verified by qPCR using ChIP Primers, BDNF Intron as a positive locus, and GAPDH promoter primers as a negative locus (Please see figures). Data is presented as percent input of each IP sample relative to input chromatin for each amplicon and ChIP sample as indicated.
      Please refer to the EZ-Magna ChIP™ A (Cat. # 17-408) or EZ-ChIP™ (Cat. # 17-371) protocol for experimental details.

      Western Blot Analysis and Peptide Inhibition:
      Representative lot data.
      Recombinant Histone H3 (Catalog # 14-411, lane 1) and chicken Core Histones (Catalog # 13-107, lane 2) were resolved by electrophoresis, transferred to nitrocellulose and probed with antitrimethyl-Histone H3 (Lys36) (1:1000 dilution) or anti-trimethyl-Histone H3 (Lys36) pre-adsorbed with 1mM histone H3 peptides containing the following modifications:
      Lane 3: monomethyl-lysine 36
      Lane 4: dimethyl-lysine 36
      Lane 5: trimethyl-lysine 36
      Lane 6: unmodified
      Proteins were visualized using a goat anti-rabbit secondary antibody conjugated to HRP and a chemiluminescence detection system. (Please see figures).

      Peptide Dot Blot Analysis:
      Representative lot data.
      A dilution series of Histone H3 peptides containing the following modifications was made:
      Column 1: unmodified
      Column 2: monomethyl-lysine 36
      Column 3: dimethyl-lysine 36
      Column 4: trimethyl-lysine 36
      2 μL of each dilution was spotted onto a PVDF membrane and probed with antitrimethyl-Histone H3 (Lys36), (1:1000 dilution).
      Peptides were visualized using a goat anti-rabbit secondary conjugated to HRP and a chemiluminescence detection system (Please see figures).

      Biological Information
      ImmunogenKLH-conjugated, synthetic peptide containing the sequence ....GVme3KKP…, in which me3K corresponds to human trimethyl-histone H3 (Lys36).
      EpitopeTrimethylated Lys36
      HostRabbit
      SpecificityRecognizes Trimethyl-Histone H3 (Lys36), Mr ~17 kDa.
      IsotypeIgG
      Species Reactivity
      • Human
      • Chicken
      Species Reactivity NoteHuman, Chicken. Wide reactivity with other species is expected.
      Antibody TypeMonoclonal Antibody
      Entrez Gene Number
      Entrez Gene SummaryHistones are basic nuclear proteins that are responsiblefor the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1,with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is located separately from the other H3 genes that are in the histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq]

      Gene Symbol
      • H3.4
      • H3/g
      • H3/t
      • H3FT
      • H3T
      • H3t
      • MGC126886
      • MGC126888
      • OTTHUMP00000037945
      Purification MethodProtein A Purfied
      UniProt Number
      UniProt SummaryFUNCTION: Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.

      SUBUNIT STRUCTURE: The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.

      SUBCELLULAR LOCATION: Nucleus.

      TISSUE SPECIFICITY: Expressed in testicular cells.

      Developmental stage Expressed during S phase, then expression strongly decreases as cell division slows down during the process of differentiation.

      PTM: Acetylation is generally linked to gene activation. Acetylation on Lys-10 impairs methylation at Arg-9. Acetylation on Lys-19 and Lys-24 favors methylation at Arg-18 By similarity.

      Citrullination at Arg-9 and/or Arg-18 by PADI4 impairs methylation and represses transcription By similarity.

      Asymmetric dimethylation at Arg-18 by CARM1 is linked to gene activation. Symmetric dimethylation at Arg-9 by PRMT5 is linked to gene repression By similarity.

      Methylation at Lys-5, Lys-37 and Lys-80 are linked to gene activation. Methylation at Lys-5 facilitates subsequent acetylation of H3 and H4. Methylation at Lys-80 is associated with DNA double-strand break (DSB) responses and is a specific target for TP53BP1. Methylation at Lys-10 and Lys-28 are linked to gene repression. Methylation at Lys-10 is a specific target for HP1 proteins (CBX1, CBX3 and CBX5) and prevents subsequent phosphorylation at Ser-11 and acetylation of H3 and H4. Methylation at Lys-5 and Lys-80 require preliminary monoubiquitination of H2B at 'Lys-120'. Methylation at Lys-10 and Lys-28 are enriched in inactive X chromosome chromatin By similarity.

      Phosphorylated at Thr-4 by GSG2/haspin during prophase and dephosphorylated during anaphase. At centromeres, specifically phosphorylated at Thr-12 from prophase to early anaphase. Phosphorylated at Ser-11 during the whole mitosis. Phosphorylation at Ser-11, which is linked to gene activation, prevents methylation at Lys-10 but facilitates acetylation of H3 and H4. Phosphorylated at Ser-29 by MLTK isoform 1, RPS6KA5 or AURKB during mitosis or upon ultraviolet B irradiation By similarity.

      Phosphorylation at 'Ser-11' is crucial for chromosome condensation and cell-cycle progression during mitosis and meiosis. In addition phosphorylation at 'Ser-11' is important during interphase because it enables the transcription of genes following external stimulation, like stress or growth factors. Phosphorylation at 'Ser-11' is also an essential regulatory mechanism for neoplastic cell transformation. Phosphorylation at 'Ser-11' by AURKB/Aurora-B mediates the dissociation of HP1 proteins (CBX1, CBX3 and CBX5) from heterochromatin.

      Ubiquitinated By similarity.

      SIMILARITY:Belongs to the histone H3 family.

      Molecular Weight~17 kDa
      Physicochemical Information
      Dimensions
      Materials Information
      Toxicological Information
      Safety Information according to GHS
      Safety Information
      Product Usage Statements
      Quality AssuranceChromatin Immunoprecipitation:
      Sonicated chromatin prepared from HeLa cells (1 X 106 cell equivalents per IP) were subjected to chromatin immuno-precipitation using 2 µg of either Normal Rabbit IgG or 2 µL Anti-trimethyl-Histone H3 (Lys36) and the Magna ChIP™ A Kit (Cat. # 17-610).
      Successful immunoprecipitation of trimethyl-Histone H3 (Lys36) associated DNA fragments was verified by qPCR using ChIP Primers, BDNF Intron (Please see figures).
      Please refer to the EZ-Magna ChIP™ A (Cat. # 17-408) or EZ-ChIP™ (Cat. # 17-371) protocol for experimental details.
      Usage Statement
      • Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.
      Storage and Shipping Information
      Storage ConditionsStable for 1 year at -20°C from date of receipt. Handling Recommendations: Upon first thaw, and prior to removing the cap, centrifuge the vial and gently mix the solution. Aliquot into microcentrifuge tubes and store at -20°C. Avoid repeated freeze/thaw cycles, which may damage IgG and affect product performance. Note: Variability in freezer temperatures below -20°C may cause glycerol containing solutions to become frozen during storage.
      Packaging Information
      Material Size25 assays
      Material Package25 assays per set. Recommended use: ~2 μL of antibody per chromatin immunoprecipitation (dependent upon biological context).
      Transport Information
      Supplemental Information
      Specifications
      Global Trade Item Number
      Catalogue Number GTIN
      17-10032 04053252679223

      Documentation

      Required Licenses

      Title
      PRODUCTO REGULADO POR LA SECRETARÍA DE SALUD

      ChIPAb+ Trimethyl-Histone H3 (Lys36) - ChIP Validated Antibody and Primer Set, rabbit monoclonal SDS

      Title

      Safety Data Sheet (SDS) 

      ChIPAb+ Trimethyl-Histone H3 (Lys36) - ChIP Validated Antibody and Primer Set, rabbit monoclonal Certificates of Analysis

      TitleLot Number
      ChIPAb+ Trimethyl-Histone H3 (Lys36) - 1951639 1951639
      ChIPAb+ Trimethyl-Histone H3 (Lys36) - 1975085 1975085
      ChIPAb+ Trimethyl-Histone H3 (Lys36) - 2034727 2034727
      ChIPAb+ Trimethyl-Histone H3 (Lys36) - 2297302 2297302
      ChIPAb+ Trimethyl-Histone H3 (Lys36) - 2433564 2433564
      ChIPAb+ Trimethyl-Histone H3 (Lys36) - 3134436 3134436
      ChIPAb+ Trimethyl-Histone H3 (Lys36) - 3386046 3386046
      ChIPAb+ Trimethyl-Histone H3 (Lys36) - 3906520 3906520
      ChIPAb+ Trimethyl-Histone H3 (Lys36) - NG1781238 NG1781238
      ChIPAb+ Trimethyl-Histone H3 (Lys36) - NG1900347 NG1900347

      References

      Reference overviewPub Med ID
      The Phaseolus vulgaris PvTRX1h gene regulates plant hormone biosynthesis in embryogenic callus from common bean.
      Barraza, A; Cabrera-Ponce, JL; Gamboa-Becerra, R; Luna-Martínez, F; Winkler, R; Álvarez-Venegas, R
      Frontiers in plant science  6  577  2015

      Show Abstract
      26284093 26284093

      Brochure

      Title
      Advance your Epigenetics Research
      Product Selection Guide - Antibodies, small molecule inhibitors, kits, assays and proteins for signaling research.

      Technical Info

      Title
      Guide to Chromatin Immunoprecipitation: Critical Factors for Success

      Related Products & Applications

      Related Products

      Product Families

      Categories

      Life Science Research > Antibodies and Assays > Immunoassays > Immunoprecipitation (IP) > Chromatin Immunoprecipitation (ChIP) > ChIP Validated Antibodies
      Life Science Research > Antibodies and Assays > Primary Antibodies
      Life Science Research > Protein Detection and Quantification > Immunoassays > Immunoprecipitation (IP) > Chromatin Immunoprecipitation (ChIP) > ChIP Validated Antibodies