Millipore Sigma Vibrant Logo
Attention: We have moved. Merck Millipore products are no longer available for purchase on MerckMillipore.com.Learn More

70006 T7SelectDOWN Primer

70006
Purchase on Sigma-Aldrich

Overview

Products

Catalogue NumberPackaging Qty/Pack
70006-3 Plastic ampoule 500 pmol
Description
OverviewT7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors.
Mr: 5987
Catalogue Number70006
Brand Family Novagen®
Product Information
Oligo seqence5ʹ - AACCCCTCAAGACCCGTTTA - 3ʹ
Quality LevelMQ100
Storage and Shipping Information
Ship Code Shipped with Blue Ice or with Dry Ice
Toxicity Standard Handling
Storage -20°C
Avoid freeze/thaw Avoid freeze/thaw
Do not freeze Ok to freeze
Global Trade Item Number
Catalogue Number GTIN
70006-3 04055977273854