17-10032 Sigma-AldrichChIPAb+ Trimethyl-Histone H3 (Lys36) - ChIP Validated Antibody and Primer Set, rabbit monoclonal
This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers.
More>> This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. Less<<Produits recommandés
Aperçu
Tableau de caractéristiques principal
Species Reactivity | Key Applications |
---|---|
H, Ch | ChIP, WB, Cell Function Assay, DB |
Product Information | |
---|---|
Format | Purified |
Control |
|
Presentation | Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50 μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Store at -20°C. Normal Rabbit IgG. One vial containing 125 µg Rabbit IgG in 125 µL of storage buffer containing 0.05% sodium azide. Store at -20°C. ChIP Primers, BDNF Intron. One vial containing 75 μL of 5 μM of each primer specific for human BDNF intron. Store at -20°C. FOR: ACCCCAACCTCTAACAGCATTA REV: TGTCTCTCAGCAGTCTTGCATT |
Quality Level | MQ100 |
Packaging Information | |
---|---|
Material Size | 25 assays |
Material Package | 25 assays per set. Recommended use: ~2 μL of antibody per chromatin immunoprecipitation (dependent upon biological context). |
Global Trade Item Number | |
---|---|
Référence | GTIN |
17-10032 | 04053252679223 |