Millipore Sigma Vibrant Logo

70006 T7SelectDOWN Primer

View Products on Sigmaaldrich.com
70006
View Pricing & Availability

Overview

Replacement Information

Pricing & Availability

Catalogue Number AvailabilityPackaging Qty/Pack Price Quantity
70006-3
Retrieving availability...
Fulfillment and Delivery Delayed
Fulfillment and Delivery Delayed
In Stock 
Discontinued
Limited Quantities Available
Availability to be confirmed
    Remaining : Will advise
      Remaining : Will advise
      Will advise
      Contact Customer Service
      Contact Customer Service

      Plastic ampoule 500 pmol
      Retrieving price...
      Price could not be retrieved
      Minimum Quantity is a multiple of
      Maximum Quantity is
      Upon Order Completion More Information
      You Saved ()
       
      Request Pricing
      Description
      OverviewT7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors.
      Mr: 5987
      Catalogue Number70006
      Brand Family Novagen®
      References
      Product Information
      Oligo seqence5ʹ - AACCCCTCAAGACCCGTTTA - 3ʹ
      Quality LevelMQ100
      Applications
      Biological Information
      Physicochemical Information
      Dimensions
      Materials Information
      Toxicological Information
      Safety Information according to GHS
      Safety Information
      Product Usage Statements
      Storage and Shipping Information
      Ship Code Shipped with Blue Ice or with Dry Ice
      Toxicity Standard Handling
      Storage -20°C
      Avoid freeze/thaw Avoid freeze/thaw
      Do not freeze Ok to freeze
      Packaging Information
      Transport Information
      Supplemental Information
      Specifications
      Global Trade Item Number
      Catalogue Number GTIN
      70006-3 04055977273854

      Documentation

      T7SelectDOWN Primer SDS

      Title

      Safety Data Sheet (SDS) 

      T7SelectDOWN Primer Certificates of Analysis

      TitleLot Number
      70006

      Citations

      Title
    • Bryan M. Wittmann, Andrea Sherk and Donald P. McDonnell. (2007) Definition of functionally important mechanistic differences among selective estrogen receptor down-regulators. Cancer Research 67, 9549-9560.
    • Jinguo Chen, et al. (2005) Tachyplesin activates the classic complement pathway to kill tumor cells. Cancer Research 65, 4614-4622.
    • Hoyee Leong, et al. (2005) Recruitment of histone deacetylase 4 to the N-terminal region of estrogen receptor alpha. Molecular Endocrinology 19, 2930-2942.
    • Ulrika Karlson, et al. (2002) Rat mast cell protease 4 is a β-chymase with unusually stringent substrate recognition profile. Journal of Biological Chemistry 277, 18579-18585.
    • Related Products & Applications

      Related Products

      Catalogue Number Description  
      70005 T7SelectUP Primer Show Pricing & Availability

      Related Products By: Brand Facete

      Categories

      Life Science Research > Genomic Analysis > DNA Preparation & Cloning > Primers