70005 Sigma-AldrichT7SelectUP Primer
Recommended Products
개요
가격 및 재고여부
카탈로그 번호 | 재고 정보 | 패킹 | 포장 단위 | 가격(VAT 별도) | 수량 | |
---|---|---|---|---|---|---|
70005-3CN |
|
Plastic ampoule | 500 pmol |
|
— |
Product Information | |
---|---|
Oligo seqence | 5ʹ - GGAGCTGTCGTATTCCAGTC - 3ʹ |
Quality Level | MQ100 |
Storage and Shipping Information | |
---|---|
Ship Code | Shipped with Blue Ice or with Dry Ice |
Toxicity | Standard Handling |
Storage | -20°C |
Avoid freeze/thaw | Avoid freeze/thaw |
Do not freeze | Ok to freeze |
Global Trade Item Number | |
---|---|
카탈로그 번호 | GTIN |
70005-3CN | 04055977273847 |