Millipore Sigma Vibrant Logo

70005 T7SelectUP Primer

View Products on Sigmaaldrich.com
70005
가격 및 재고 조회

개요

가격 및 재고여부

카탈로그 번호 재고 정보패킹 포장 단위 가격(VAT 별도) 수량
70005-3CN
현재 재고 없음
현재 재고 없음
예상 출고 가능일 
단종품
제한된 수량 가능
재고여부 확인
    Remaining: will advise
      Remaining: will advise
      추천사항
      고객 서비스로 문의
      Contact Customer Service

      Plastic ampoule 500 pmol
      가격을 검색할 수 없습니다
      Minimum Quantity needs to be mulitiple of
      Maximum Quantity is
      가격 문의 추가 정보
      ()이 할인됨
       
      가격 문의
      Description
      OverviewT7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors.
      Mr: 6105
      Catalogue Number70005
      Brand Family Novagen®
      Product Information
      Oligo seqence5ʹ - GGAGCTGTCGTATTCCAGTC - 3ʹ
      Quality LevelMQ100
      Storage and Shipping Information
      Ship Code Shipped with Blue Ice or with Dry Ice
      Toxicity Standard Handling
      Storage -20°C
      Avoid freeze/thaw Avoid freeze/thaw
      Do not freeze Ok to freeze
      Global Trade Item Number
      카탈로그 번호 GTIN
      70005-3CN 04055977273847