70005 Sigma-AldrichT7SelectUP Primer
Prodotti consigliati
Panoramica
Replacement Information |
---|
Products
Numero di catalogo | Confezionamento | Qtà/conf | |
---|---|---|---|
70005-3 | Fiala di plastica | 500 pmol |
References |
---|
Product Information | |
---|---|
Oligo seqence | 5ʹ - GGAGCTGTCGTATTCCAGTC - 3ʹ |
Quality Level | MQ100 |
Applications |
---|
Biological Information |
---|
Physicochemical Information |
---|
Dimensions |
---|
Materials Information |
---|
Toxicological Information |
---|
Safety Information according to GHS |
---|
Safety Information |
---|
Product Usage Statements |
---|
Storage and Shipping Information | |
---|---|
Ship Code | Shipped with Blue Ice or with Dry Ice |
Toxicity | Standard Handling |
Storage | -20°C |
Avoid freeze/thaw | Avoid freeze/thaw |
Do not freeze | Ok to freeze |
Packaging Information |
---|
Transport Information |
---|
Supplemental Information |
---|
Specifications |
---|
Global Trade Item Number | |
---|---|
Numero di catalogo | GTIN |
70005-3 | 04055977273847 |
Documentation
T7SelectUP Primer MSDS
Titolo |
---|
T7SelectUP Primer Certificati d'Analisi
Titolo | Numero di lotto |
---|---|
70005 |
Citazioni
Titolo | |
---|---|
|