Millipore Sigma Vibrant Logo
Attenzione: Ci siamo trasferiti. Non è più possibile acquistare i prodotti Merck Millipore nel sito MerckMillipore.comPer saperne di più

70006 T7SelectDOWN Primer

T7SelectDOWN Primer: MSDS (material safety data sheet) o SDS, certificato d’analisi (CoA) e certificato di qualità (CoQ), dossier, brochure e altri documenti disponibili.
70006
Purchase on Sigma-Aldrich

Panoramica

Replacement Information

Products

Numero di catalogoConfezionamento Qtà/conf
70006-3 Fiala di plastica 500 pmol
Description
OverviewT7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors.
Mr: 5987
Catalogue Number70006
Brand Family Novagen®
References
Product Information
Oligo seqence5ʹ - AACCCCTCAAGACCCGTTTA - 3ʹ
Quality LevelMQ100
Applications
Biological Information
Physicochemical Information
Dimensions
Materials Information
Toxicological Information
Safety Information according to GHS
Safety Information
Product Usage Statements
Storage and Shipping Information
Ship Code Shipped with Blue Ice or with Dry Ice
Toxicity Standard Handling
Storage -20°C
Avoid freeze/thaw Avoid freeze/thaw
Do not freeze Ok to freeze
Packaging Information
Transport Information
Supplemental Information
Specifications
Global Trade Item Number
Numero di catalogo GTIN
70006-3 04055977273854

Documentation

T7SelectDOWN Primer MSDS

Titolo

Scheda di sicurezza (MSDS) 

T7SelectDOWN Primer Certificati d'Analisi

TitoloNumero di lotto
70006

Citazioni

Titolo
  • Bryan M. Wittmann, Andrea Sherk and Donald P. McDonnell. (2007) Definition of functionally important mechanistic differences among selective estrogen receptor down-regulators. Cancer Research 67, 9549-9560.
  • Jinguo Chen, et al. (2005) Tachyplesin activates the classic complement pathway to kill tumor cells. Cancer Research 65, 4614-4622.
  • Hoyee Leong, et al. (2005) Recruitment of histone deacetylase 4 to the N-terminal region of estrogen receptor alpha. Molecular Endocrinology 19, 2930-2942.
  • Ulrika Karlson, et al. (2002) Rat mast cell protease 4 is a β-chymase with unusually stringent substrate recognition profile. Journal of Biological Chemistry 277, 18579-18585.
    		•