Millipore Sigma Vibrant Logo

70006 T7SelectDOWN Primer

View Products on Sigmaaldrich.com
70006
View Pricing & Availability

Overview

Pricing & Availability

Catalogue Number AvailabilityPackaging Qty/Pack Price Quantity
70006-3
Limited Availability
Limited Availability
In Stock 
Discontinued
Limited Quantities Available
Availability to be confirmed
    Remaining : Will advise
      Remaining : Will advise
      Will advise
      Contact Customer Service
      Contact Customer Service

      Ampul plastik 500 pmol
      Price could not be retrieved
      Minimum Quantity is a multiple of
      Maximum Quantity is
      Upon Order Completion More Information
      You Saved ()
       
      Request Pricing
      Description
      OverviewT7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors.
      Mr: 5987
      Catalogue Number70006
      Brand Family Novagen®
      Product Information
      Oligo seqence5ʹ - AACCCCTCAAGACCCGTTTA - 3ʹ
      Quality LevelMQ100
      Storage and Shipping Information
      Ship Code Shipped with Blue Ice or with Dry Ice
      Toxicity Standard Handling
      Storage -20°C
      Avoid freeze/thaw Avoid freeze/thaw
      Do not freeze Ok to freeze
      Global Trade Item Number
      Catalogue Number GTIN
      70006-3 04055977273854