70005 Sigma-AldrichT7SelectUP Primer
Recommended Products
Áttekintés
Products
Katalógusszám | Csomagolás | Menny./csomag | |
---|---|---|---|
70005-3 | Muanyagampulla | 500 pmol |
Product Information | |
---|---|
Oligo seqence | 5ʹ - GGAGCTGTCGTATTCCAGTC - 3ʹ |
Quality Level | MQ100 |
Storage and Shipping Information | |
---|---|
Ship Code | Shipped with Blue Ice or with Dry Ice |
Toxicity | Standard Handling |
Storage | -20°C |
Avoid freeze/thaw | Avoid freeze/thaw |
Do not freeze | Ok to freeze |
Global Trade Item Number | |
---|---|
Katalógusszám | GTIN |
70005-3 | 04055977273847 |