Mesenchymal stem cells in rabbit meniscus and bone marrow exhibit a similar feature but a heterogeneous multi-differentiation potential: superiority of meniscus as a cell source for meniscus repair. Ding, Z; Huang, H BMC musculoskeletal disorders
16
65
2015
Show Abstract
The restoration of damaged meniscus has always been a challenge due to its limited healing capacity. Recently, bone marrow-derived mesenchymal stem cells (BMSCs) provide a promising alternative to repair meniscal defects. However, BMSCs are not ideal chondroprogenitor cells for meniscus repair because they have a high propensity for cartilage hypertrophy and bone formation. Our hypothesis is that mesenchymal stem cells (MSCs) reside in meniscus maintain specific traits distinct from others which may be more conducive to meniscus regeneration.MSCs were isolated from bone marrow and menisci of the rabbits. The similarities and differences between BMSCs and MMSCs were investigated in vitro by a cell culture model, ex vivo by a rabbit meniscus defect model and in vivo by a nude rat implantation model using histochemistry, immunocytochemistry, qRT-PCR and western blotting.Our data showed that two types of MSCs have universal stem cell characteristics including clonogenicity, multi-potency and self-renewal capacity. They both express stem cell markers including SSEA-4, Nanog, nucleostemin, strol-1, CD44 and CD90. However, MMSCs differed from BMSCs. MMSC colonies were much smaller and grew more slowly than BMSC colonies. Moreover, fewer MMSCs expressed CD34 than BMSCs. Finally, MMSCs always appeared a pronounced tendency to chondrogenic differentiation while BMSCs exhibited significantly greater osteogenic potential, whatever in vitro and in vivo.This study shows the similarities and differences between MMSCs and BMSCs for the first time. MMSCs are a promising source of mesenchymal stem cells in repairing meniscus defect. | | 25887689
![25887689](/INTERSHOP/static/WFS/Merck-GB-Site/-/-/en_US/images/outbound-arrow.png) |
Formation of nuclear bodies by the lncRNA Gomafu-associating proteins Celf3 and SF1. Ishizuka, A; Hasegawa, Y; Ishida, K; Yanaka, K; Nakagawa, S Genes to cells : devoted to molecular & cellular mechanisms
19
704-21
2014
Show Abstract
Gomafu/MIAT/Rncr2 is a long noncoding RNA that has been proposed to control retinal cell specification, stem cell differentiation and alternative splicing of schizophrenia-related genes. However, how Gomafu controls these biological processes at the molecular level has remained largely unknown. In this study, we identified the RNA-binding protein Celf3 as a novel Gomafu-associating protein. Knockdown of Celf3 led to the down-regulation of Gomafu, and cross-link RNA precipitation analysis confirmed specific binding between Celf3 and Gomafu. In the neuroblastoma cell line Neuro2A, Celf3 formed novel nuclear bodies (named CS bodies) that colocalized with SF1, another Gomafu-binding protein. Gomafu, however, was not enriched in the CS bodies; instead, it formed distinct nuclear bodies in separate regions in the nucleus. These observations suggest that Gomafu indirectly modulates the function of the splicing factors SF1 and Celf3 by sequestering these proteins into separate nuclear bodies. | | 25145264
![25145264](/INTERSHOP/static/WFS/Merck-GB-Site/-/-/en_US/images/outbound-arrow.png) |
Differential distribution of HP1 proteins after trichostatin a treatment influences chromosomal stability in HCT116 and WI-38 cells. González-Barrios, R; Soto-Reyes, E; Quiroz-Baez, R; Fabián-Morales, E; Díaz-Chávez, J; Del Castillo, V; Mendoza, J; López-Saavedra, A; Castro, C; Herrera, LA Cell division
9
6
2014
Show Abstract
Heterochromatin protein 1 (HP1) is important in the establishment, propagation, and maintenance of constitutive heterochromatin, especially at the pericentromeric region. HP1 might participate in recruiting and directing Mis12 to the centromere during interphase, and HP1 disruption or abrogation might lead to the loss of Mis12 incorporation into the kinetochore. Therefore, the centromere structure and kinetochore relaxation that are promoted in the absence of Mis12 could further induce chromosome instability (CIN) by reducing the capacity of the kinetochore to anchor microtubules. The aim of this study was to determine whether alterations in the localization of HP1 proteins induced by trichostatin A (TSA) modify Mis12 and Centromere Protein A (CENP-A) recruitment to the centromere and whether changes in the expression of HP1 proteins and H3K9 methylation at centromeric chromatin increase CIN in HCT116 and WI-38 cells.HCT116 and WI-38 cells were cultured and treated with TSA to evaluate CIN after 24 and 48 h of exposure. Immunofluorescence, Western blot, ChIP, and RT-PCR assays were performed in both cell lines to evaluate the localization and abundance of HP1α/β, Mis12, and CENP-A and to evaluate chromatin modifications during interphase and mitosis, as well as after 24 and 48 h of TSA treatment.Our results show that the TSA-induced reduction in heterochromatic histone marks on centromeric chromatin reduced HP1 at the centromere in the non-tumoral WI-38 cells and that this reduction was associated with cell cycle arrest and CIN. However, in HCT116 cells, HP1 proteins, together with MIS12 and CENP-A, relocated to centromeric chromatin in response to TSA treatment, even after H3K9me3 depletion in the centromeric nucleosomes. The enrichment of HP1 and the loss of H3K9me3 were associated with an increase in CIN, suggesting a response mechanism at centromeric and pericentromeric chromatin that augments the presence of HP1 proteins in those regions, possibly ensuring chromosome segregation despite serious CIN. Our results provide new insight into the epigenetic landscape of centromeric chromatin and the role of HP1 proteins in CIN. | | 25729403
![25729403](/INTERSHOP/static/WFS/Merck-GB-Site/-/-/en_US/images/outbound-arrow.png) |
Cell type and tissue specific function of islet genes in zebrafish pancreas development. Wilfinger, A; Arkhipova, V; Meyer, D Developmental biology
378
25-37
2013
Show Abstract
Isl1 is a LIM homeobox transcription factor showing conserved expression in the developing and mature vertebrate pancreas. So far, functions of pancreatic Isl1 have mainly been studied in the mouse, where Isl1 has independent functions during formation of exocrine and endocrine tissues. Here, we take advantage of a recently described isl1 mutation in zebrafish to address pancreatic isl1 functions in a non-mammalian system. Isl1 in zebrafish, as in mouse, shows transient expression in mesenchyme flanking the pancreatic endoderm, and continuous expression in all endocrine cells. In isl1 mutants, endocrine cells are specified in normal numbers but more than half of these cells fail to establish expression of endocrine hormones. By using a lineage tracking approach that highlights cells leaving cell cycle early in development, we show that isl1 functions are different in first and second wave endocrine cells. In isl1 mutants, early forming first wave cells show virtually no glucagon expression and a reduced number of cells expressing insulin and somatostatin, while in the later born second wave cells somatostatin expressing cells are strongly reduced and insulin and glucagon positive cells form in normal numbers. Isl1 mutant zebrafish also display a smaller exocrine pancreas. We find that isl1 expression in the pancreatic mesenchyme overlaps with that of the related genes isl2a and isl2b and that pancreatic expression of isl-genes is independent of each other. As a combined block of two or three isl1/2 genes results in a dose-dependent reduction of exocrine tissue, our data suggest that all three genes cooperatively contribute to non-cell autonomous exocrine pancreas extension. The normal expression of the pancreas mesenchyme markers meis3, fgf10 and fgf24 in isl1/2 depleted embryos suggests that this activity is independent of isl-gene function in pancreatic mesenchyme formation as was found in mouse. This indicates species-specific differences in the requirement for isl-genes in pancreatic mesenchyme formation. Overall, our data reveal a novel interaction of isl1 and isl2 genes in exocrine pancreas expansion and cell type specific requirements during endocrine cell maturation. | | 23518338
![23518338](/INTERSHOP/static/WFS/Merck-GB-Site/-/-/en_US/images/outbound-arrow.png) |
STE20/SPS1-related proline/alanine-rich kinase is involved in plasticity of GABA signaling function in a mouse model of acquired epilepsy. Yang, L; Cai, X; Zhou, J; Chen, S; Chen, Y; Chen, Z; Wang, Q; Fang, Z; Zhou, L PloS one
8
e74614
2013
Show Abstract
The intracellular concentration of chloride ([Cl(-)]i) determines the strength and polarity of GABA neurotransmission. STE20/SPS1-related proline/alanine-rich kinase (SPAK) is known as an indirect regulator of [Cl(-)]i for its activation of Na-K-2 Cl(-)co-transporters (NKCC) and inhibition of K-Cl(-)co-transporters (KCC) in many organs. NKCC1 or KCC2 expression changes have been demonstrated previously in the hippocampal neurons of mice with pilocarpine-induced status epilepticus (PISE). However, it remains unclear whether SPAK modulates [Cl(-)]i via NKCC1 or KCC2 in the brain. Also, there are no data clearly characterizing SPAK expression in cortical or hippocampal neurons or confirming an association between SPAK and epilepsy. In the present study, we examined SPAK expression and co-expression with NKCC1 and KCC2 in the hippocampal neurons of mice with PISE, and we investigated alterations in SPAK expression in the hippocampus of such mice. Significant increases in SPAK mRNA and protein levels were detected during various stages of PISE in the PISE mice in comparison to levels in age-matched sham (control) and blank treatment (control) mice. SPAK and NKCC1 expression increased in vitro, while KCC2 was down-regulated in hippocampal neurons following hypoxic conditioning. However, SPAK overexpression did not influence the expression levels of NKCC1 or KCC2. Using co-immunoprecipitation, we determined that the intensity of interaction between SPAK and NKCC1 and between SPAK and KCC2 increased markedly after oxygen-deprivation, whereas SPAK overexpression strengthened the relationships. The [Cl(-)]i of hippocampal neurons changed in a corresponding manner under the different conditions. Our data suggests that SPAK is involved in the plasticity of GABA signaling function in acquired epilepsy via adjustment of [Cl(-)]i in hippocampal neurons. | | 24058604
![24058604](/INTERSHOP/static/WFS/Merck-GB-Site/-/-/en_US/images/outbound-arrow.png) |
Therapeutic laquinimod treatment decreases inflammation, initiates axon remyelination, and improves motor deficit in a mouse model of multiple sclerosis. Moore, S; Khalaj, AJ; Yoon, J; Patel, R; Hannsun, G; Yoo, T; Sasidhar, M; Martinez-Torres, L; Hayardeny, L; Tiwari-Woodruff, SK Brain and behavior
3
664-82
2013
Show Abstract
Therapeutic strategies that induce effective neuroprotection and enhance intrinsic repair mechanisms are central goals for future treatment of multiple sclerosis (MS), as well as other diseases. Laquinimod (LQ) is an orally administered, central nervous system (CNS)-active immunomodulator with demonstrated efficacy in MS clinical trials and a favorable safety and tolerability profile.We aimed to explore the pathological, functional, and behavioral consequences of prophylactic and therapeutic (after presentation of peak clinical disease) LQ treatment in the chronic experimental autoimmune encephalomyelitis (EAE) mouse model of MS.Active EAE-induced 8-week-old C57BL/6 mice were treated with 5 or 25 mg/kg/day LQ via oral gavage beginning on EAE post-immunization day 0, 8, or 21. Clinical scores and rotorod motor performance were assessed throughout the disease course. Immune analysis of autoantigen-stimulated splenocytes, electrophysiological conduction of callosal axons, and immunohistochemistry of white matter-rich corpus callosum and spinal cord were performed.Prophylactic and therapeutic treatment with LQ significantly decreased mean clinical disease scores, inhibited Th1 cytokine production, and decreased the CNS inflammatory response. LQ-induced improvement in axon myelination and integrity during EAE was functional, as evidenced by significant recovery of callosal axon conduction and axon refractoriness and pronounced improvement in rotorod motor performance. These improvements correlate with LQ-induced attenuation of EAE-induced demyelination and axon damage, and improved myelinated axon numbers.Even when initiated at peak disease, LQ treatment has beneficial effects within the chronic EAE mouse model. In addition to its immunomodulatory effects, the positive effects of LQ treatment on oligodendrocyte numbers and myelin density are indicative of significant, functional neuroprotective and neurorestorative effects.Our results support a potential neuroprotective, in addition to immunomodulatory, effect of LQ treatment in inhibiting ongoing MS/EAE disease progression. | | 24363970
![24363970](/INTERSHOP/static/WFS/Merck-GB-Site/-/-/en_US/images/outbound-arrow.png) |
The cAMP effector EPAC activates Elk1 transcription factor in prostate smooth muscle, and is a minor regulator of α1-adrenergic contraction. Hennenberg, M; Strittmatter, F; Schmetkamp, H; Rutz, B; Walther, S; Stief, CG; Gratzke, C Journal of biomedical science
20
46
2013
Show Abstract
Prostate smooth muscle tone is regulated by α1-adrenoceptor-induced contraction and cAMP-mediated relaxation. EPAC is an effector of cAMP, being involved in smooth muscle relaxation and cell cycle control outside the lower urinary tract. Here, we investigated the expression and function of EPAC in human prostate tissues from patients undergoing radical prostatectomy.mRNA and protein expression of EPAC was detected in all prostate tissues by RT-PCR and Western blot analysis. Immunoreactivity was observed in stromal cells, and colocalized with immunofluorescence for α-smooth muscle actin and calponin. Under normal conditions, noradrenaline- or phenylephrine-induced contraction of prostate strips in the organ bath was not affected by the EPAC activator pCPT (SP-8-pCPT-2'-O-Me-cAMPS.NA) (30 μM). However, when the cyclooxygenase inhibitor indomethacin (50 μM) was added, EPAC activators pCPT and OME (8-CPT-2'-O-Me-cAMP.Na) (30 μM) significantly reduced contractions by low concentrations of phenylephrine. These effects were not observed on noradrenaline-induced contraction. OME and pCPT caused phosphorylation of the transcription factor Elk1 in prostate tissues. Elk1 activation was confirmed by EMSA (electrophoretic mobility shift assay), where OME and pCPT incresed Elk1 binding to a specific DNA probe.EPAC activation may reduce α1-adrenergic prostate contraction in the human prostate, although this effect is masked by cyclooxygenases and β-adrenoceptors. A main EPAC function in the human prostate may be the regulation of the transcription factor Elk1. | | 23815815
![23815815](/INTERSHOP/static/WFS/Merck-GB-Site/-/-/en_US/images/outbound-arrow.png) |
Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle. Hennenberg, M; Strittmatter, F; Beckmann, C; Rutz, B; Füllhase, C; Waidelich, R; Montorsi, F; Hedlund, P; Andersson, KE; Stief, CG; Gratzke, C PloS one
7
e50904
2012
Show Abstract
The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs.To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation.Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA).Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues.Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation. | | 23226423
![23226423](/INTERSHOP/static/WFS/Merck-GB-Site/-/-/en_US/images/outbound-arrow.png) |
Malat1 is not an essential component of nuclear speckles in mice. Nakagawa, S; Ip, JY; Shioi, G; Tripathi, V; Zong, X; Hirose, T; Prasanth, KV RNA
18
1487-99
2012
Show Abstract
Malat1 is an abundant long, noncoding RNA that localizes to nuclear bodies known as nuclear speckles, which contain a distinct set of pre-mRNA processing factors. Previous studies in cell culture have demonstrated that Malat1 interacts with pre-mRNA splicing factors, including the serine- and arginine-rich (SR) family of proteins, and regulates a variety of biological processes, including cancer cell migration, synapse formation, cell cycle progression, and responses to serum stimulation. To address the physiological function of Malat1 in a living organism, we generated Malat1-knockout (KO) mice using homologous recombination. Unexpectedly, the Malat1-KO mice were viable and fertile, showing no apparent phenotypes. Nuclear speckle markers were also correctly localized in cells that lacked Malat1. However, the cellular levels of another long, noncoding RNA--Neat1--which is an architectural component of nuclear bodies known as paraspeckles, were down-regulated in a particular set of tissues and cells lacking Malat1. We propose that Malat1 is not essential in living mice maintained under normal laboratory conditions and that its function becomes apparent only in specific cell types and under particular conditions. | | 22718948
![22718948](/INTERSHOP/static/WFS/Merck-GB-Site/-/-/en_US/images/outbound-arrow.png) |
Endothelin-1, the unfolded protein response, and persistent inflammation: role of pulmonary artery smooth muscle cells. Yeager, ME; Belchenko, DD; Nguyen, CM; Colvin, KL; Ivy, DD; Stenmark, KR American journal of respiratory cell and molecular biology
46
14-22
2012
Show Abstract
Endothelin-1 is a potent vasoactive peptide that occurs in chronically high levels in humans with pulmonary hypertension and in animal models of the disease. Recently, the unfolded protein response was implicated in a variety of diseases, including pulmonary hypertension. In addition, evidence is increasing for pathological, persistent inflammation in the pathobiology of this disease. We investigated whether endothelin-1 might engage the unfolded protein response and thus link inflammation and the production of hyaluronic acid by pulmonary artery smooth muscle cells. Using immunoblot, real-time PCR, immunofluorescence, and luciferase assays, we found that endothelin-1 induces both a transcriptional and posttranslational activation of the three major arms of the unfolded protein response. The pharmacologic blockade of endothelin A receptors, but not endothelin B receptors, attenuated the observed release, as did a pharmacologic blockade of extracellular signal-regulated kinases 1 and 2 (ERK-1/2) signaling. Using short hairpin RNA and ELISA, we observed that the release by pulmonary artery smooth muscle cells of inflammatory modulators, including hyaluronic acid, is associated with endothelin-1-induced ERK-1/2 phosphorylation and the unfolded protein response. Furthermore, the synthesis of hyaluronic acid induced by endothelin-1 is permissive for persistent THP-1 monocyte binding. These results suggest that endothelin-1, in part because it induces the unfolded protein response in pulmonary artery smooth muscle cells, triggers proinflammatory processes that likely contribute to vascular remodeling in pulmonary hypertension. | | 21778413
![21778413](/INTERSHOP/static/WFS/Merck-GB-Site/-/-/en_US/images/outbound-arrow.png) |