Millipore Sigma Vibrant Logo

70006 T7SelectDOWN Primer

View Products on Sigmaaldrich.com
70006
Voir les Prix & la Disponibilité

Aperçu

Replacement Information

Prix & Disponibilité

Référence DisponibilitéConditionnement Qté Prix Quantité
70006-3
Récupération des données relatives à la disponibilité...
Disponibilité limitée
Disponibilité limitée
En stock 
Interrompu(e)
Disponible en quantités limitées
Disponibilité à confirmer
    Pour le restant : Nous vous tiendrons informé
      Pour le restant : Nous vous tiendrons informé
      Nous vous tiendrons informé
      Contacter le Service Clients
      Contact Customer Service

      Ampoule plast. 500 pmol
      Prix en cours de récupération
      Le prix n'a pas pu être récupéré
      La quantité minimale doit être un multiple de
      Maximum Quantity is
      À la validation de la commande Plus d'informations
      Vous avez sauvegardé ()
       
      Demander le prix
      Description
      OverviewT7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors.
      Mr: 5987
      Catalogue Number70006
      Brand Family Novagen®
      References
      Product Information
      Oligo seqence5ʹ - AACCCCTCAAGACCCGTTTA - 3ʹ
      Quality LevelMQ100
      Applications
      Biological Information
      Physicochemical Information
      Dimensions
      Materials Information
      Toxicological Information
      Safety Information according to GHS
      Safety Information
      Product Usage Statements
      Storage and Shipping Information
      Ship Code Shipped with Blue Ice or with Dry Ice
      Toxicity Standard Handling
      Storage -20°C
      Avoid freeze/thaw Avoid freeze/thaw
      Do not freeze Ok to freeze
      Packaging Information
      Transport Information
      Supplemental Information
      Specifications
      Global Trade Item Number
      Référence GTIN
      70006-3 04055977273854

      Documentation

      T7SelectDOWN Primer FDS

      Titre

      Fiche de données de sécurité des matériaux (FDS) 

      T7SelectDOWN Primer Certificats d'analyse

      TitreNuméro de lot
      70006

      Citations

      Titre
    • Bryan M. Wittmann, Andrea Sherk and Donald P. McDonnell. (2007) Definition of functionally important mechanistic differences among selective estrogen receptor down-regulators. Cancer Research 67, 9549-9560.
    • Jinguo Chen, et al. (2005) Tachyplesin activates the classic complement pathway to kill tumor cells. Cancer Research 65, 4614-4622.
    • Hoyee Leong, et al. (2005) Recruitment of histone deacetylase 4 to the N-terminal region of estrogen receptor alpha. Molecular Endocrinology 19, 2930-2942.
    • Ulrika Karlson, et al. (2002) Rat mast cell protease 4 is a β-chymase with unusually stringent substrate recognition profile. Journal of Biological Chemistry 277, 18579-18585.
    • Produits & Applications associés

      Related Products

      Référence Description  
      70005 T7SelectUP Primer Prix & Disponibilité

      Produits associés classés par : Brand Facete

      Catégories

      Life Science Research > Genomic Analysis > DNA Preparation & Cloning > Primers