Millipore Sigma Vibrant Logo
Atención: Nos hemos mudado. Los productos Merck Millipore ya no pueden adquirirse en MerckMillipore.comMás información

70005 T7SelectUP Primer

T7SelectUP Primer: Ficha de datos de seguridad (MSDS o SDS), certificado de análisis y de calidad (CoA y CoQ), expedientes, folletos y otros documentos disponibles.
70005
Purchase on Sigma-Aldrich

Descripción

Replacement Information

Products

Número de referenciaEmbalaje Cant./Env.
70005-3 Ampolla de plást. 500 pmol
Description
OverviewT7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors.
Mr: 6105
Catalogue Number70005
Brand Family Novagen®
References
Product Information
Oligo seqence5ʹ - GGAGCTGTCGTATTCCAGTC - 3ʹ
Quality LevelMQ100
Applications
Biological Information
Physicochemical Information
Dimensions
Materials Information
Toxicological Information
Safety Information according to GHS
Safety Information
Product Usage Statements
Storage and Shipping Information
Ship Code Shipped with Blue Ice or with Dry Ice
Toxicity Standard Handling
Storage -20°C
Avoid freeze/thaw Avoid freeze/thaw
Do not freeze Ok to freeze
Packaging Information
Transport Information
Supplemental Information
Specifications
Global Trade Item Number
Número de referencia GTIN
70005-3 04055977273847

Documentation

T7SelectUP Primer Ficha datos de seguridad (MSDS)

Título

Ficha técnica de seguridad del material (MSDS) 

T7SelectUP Primer Certificados de análisis

CargoNúmero de lote
70005

Citas

Título
  • Bryan M. Wittmann, Andrea Sherk and Donald P. McDonnell. (2007) Definition of functionally important mechanistic differences among selective estrogen receptor down-regulators. Cancer Research 67, 9549-9560.
  • Jinguo Chen, et al. (2005) Tachyplesin activates the classic complement pathway to kill tumor cells. Cancer Research 65, 4614-4622.
  • Hoyee Leong, et al. (2005) Recruitment of histone deacetylase 4 to the N-terminal region of estrogen receptor alpha. Molecular Endocrinology 19, 2930-2942.
  • Ulrika Karlson, et al. (2002) Rat mast cell protease 4 is a β-chymase with unusually stringent substrate recognition profile. Journal of Biological Chemistry 277, 18579-18585.
    		•